ABSTRACT:

In this study we investigate the effect of a single session of

high-intensity contractions on expression of pleiotropic genes and, in
particular, those genes associated with metabolism in soleus muscle from
electrically stimulated (ES) and contralateral (CL) limbs. The right limbs of
male Wistar rats were submitted to contractions by 200-ms trains of
electrical stimulation at 100-H

Z

frequency with pulses of 0.1 ms (voltage 24

 3 V) delivered each second for 1 hour. Soleus muscles were isolated 1
hour after contraction, and gene expression was analyzed by a macroarray
technique (Atlas Toxicology 1.2 Array; Clontech Laboratories). Electrical
stimulation increased expression in 92 genes (16% of the genes present in
the membrane). Sixty-six genes were upregulated in both ES and CL soleus
muscles, and expression of 26 genes was upregulated in the ES muscle
only. The most altered genes were those related to stress response and
metabolism. Electrical stimulation also raised expression of transcription
factors, translation and posttranslational modification of proteins, ribosomal
proteins, and intracellular transducers/effectors/modulators. The results
indicate that a single session of electrical stimulation upregulated expression
of genes related to metabolism and oxidative stress in soleus muscle from
both ES and CL limbs. These findings may indicate an association with
tissue hypertrophy and metabolic adaptations induced by physical exercise
training not only in the ES but also in the CL non-stimulated muscle,
suggesting a cross-education phenomenon.

Muscle Nerve 40: 838–846, 2009

CHANGES OF GENE EXPRESSION IN
ELECTRICALLY STIMULATED AND
CONTRALATERAL RAT SOLEUS MUSCLES

AURE´LIO PIMENTA, PhD,

1

RENATA GORJA˜O, PhD,

1,2

LEONARDO R. SILVEIRA, PhD,

1

and RUI CURI, PhD

1

1

National Institute of Obesity and Diabetes/Department of Physiology and Biophysics,
Institute of Biomedical Sciences, University of Sa˜o Paulo, Sa˜o Paulo, Avenida Prof.
Lineu Prestes 1524, 05508-900, Butanta˜, Sa˜o Paulo, SP, Brazil

2

Department of Pharmacy, UNIBAN, Sa˜o Paulo, SP, Brazil

Accepted 23 February 2009

R

egular exercise training promotes several mor-

phological

and

physiological

changes

in

the

human musculoskeletal system. This mechanism is
blunted as soon as the stimulus that promoted the

changes ceases.

1

According to the overload princi-

ple, strength gains are not reached unless the
training intensity exceeds a certain threshold. In
addition, strength gain as well as neuromuscular
adaptations exhibit high specificity, which means
that functional and structural adaptations are re-
stricted to the muscle subjected to exercise stress.
However, it has been reported that long-term uni-
lateral training may affect the homologous muscle
in the contralateral limb. This phenomenon,
known as cross-education, was first described more
than a century ago.

2

Cross-education may help pre-

vent strength loss in an injured limb if the oppo-
site contralateral (CL) limb is trained. Kannus
et al.

3

observed that a 3-week period of training

in quadriceps muscle leads to an increase of 14%
in the strength of the CL quadriceps muscle in
humans. This observation supports the proposition

Abbreviations: CAT, catalase; CL, contralateral; CS, citrate synthase;
CT,

cycle

threshold;

dATP,

deoxyadenosine

triphosphate;

dCTP,

deoxycytidine triphosphate; dGTP, deoxyguanosine triphosphate; DTT,
dithiothreitol;

dTTP,

deoxythymidine

triphosphate;

ERK,

extracellular

signal–related kinase; ES, electrically stimulated; GAPDH, glyceraldehyde-
3-phosphate dehydrogenase; GPX, glutathione peroxidase; HSP, heat
shock protein; JNK, Jun kinase; MAPK, mitogen-activated protein kinase;
MEK, mitogen-activated protein kinase kinase; PCR, polymerase chain
reaction; RT-PCR, reverse transcription–polymerase chain reaction; SOD,
superoxide dismutase

Correspondence to: R. Gorja˜o; e-mail: renatag@icb.usp.br

V

C

2009 Wiley Periodicals, Inc.

Published

online

31

August

2009

in

Wiley

InterScience

(www.

interscience.wiley.com). DOI 10.1002/mus.21360

Key words: cross-education; gene expression; skeletal muscle;
metabolism; macroarray; electrical; stimulation; protein synthesis; exercise;
soleus muscle

838

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

that keeping the uninjured limb active may benefit
the injured one. For athletes, this may speed-up
the return to competition and, in the case of el-
derly and injured patients, it would reduce the pe-
riod of convalescence in bed and attendant risk of
secondary complications.

As a consequence of muscle contraction that

occurs during exercise, mechanical and biochemi-
cal mechanisms trigger coordinated signals that
modulate expression of key genes responsible for
cell structure and function.

4–6

These changes lead

to adaptations usually observed in trained subjects.
There is evidence of significant hypertrophy (10%)
in the untrained CL muscle

7

and increased force

output after a training program in the CL unstimu-
lated muscle.

2

However, there are few data regard-

ing molecular changes in the CL limb after electri-
cal stimulation–induced muscle contraction.

The aim of this study was to examine changes

induced by a single session of electrical stimulation
on expression of genes (mRNA) associated with
muscle hypertrophy and metabolism in the electri-
cally stimulated (ES) and CL soleus muscles from
the stimulated group, as compared with control
non-stimulated rats, by using macroarray and real-
time polymerase chain reaction (PCR) techniques.
Several studies have addressed soleus muscle func-
tion and metabolism. Thus, there is reason to
investigate the effect of ES on molecular mecha-
nisms in soleus muscle. The soleus muscle was also
chosen due to the well-established association
between selected genes and oxidative capacity.

METHODS

Reagents.

Sodium

pentobarbital

was

obtained

from Cristalia (Itapira, SP, Brazil); Trizol, random
primers, deoxycytidine triphosphate (dCTP), deox-
yguanosine triphosphate (dGTP), deoxythymidine
triphosphate

(dTTP),

deoxyadenosine

triphos-

phate (dATP), MgCl

2

, DNAse buffer, DNAse, and

Platinum SYBR Green qPCR SuperMix-UDG were
purchased from Invitrogen (Carlsbad, California).
Sodium dodecylsulfate (SDS) was obtained from
Merck (Darmstadt, Germany). Primers for glyceral-
dehyde-3-phosphate dehydrogenase (GAPDH), cat-
alase, superoxide dismutase 2 (SOD2), heat shock
protein 70 (HSP70), HSP90, and mitogen-activated
protein kinase 1 (MEK) were from IDT (Coralville,
Iowa). Express hybridization solution and termina-
tion mix were obtained from Clontech Laborato-
ries (Mountain View, California). Reverse transcrip-
tase Revertaid M-MuLV was from MBI Fermentas

(Burlington, Ontario, Canada).

33

P-labeled ATP

was purchased from GE Healthcare (Waukesha,
Wisconsin).

Animals.

Twenty male adult (9 weeks of age,

about 200 g) albino rats (Wistar strain) from the
Institute of Biomedical Sciences of the University
of Sa˜o Paulo were divided in two groups: (a) con-
trol (n

¼ 10) and (b) electrically stimulated (n ¼

10). In the electrically stimulated group, we exam-
ined the stimulated (ES) and the contralateral
non-stimulated (CL) soleus muscles.

The rats were housed 5 per cage at 20



–23



C

and a 12:12-hour light–dark cycle and had ad libi-
tum access to rat chow (Nuvilab CR1; Nuvital
Nutrientes, Curitiba, Parana´) and water. The ex-
perimental protocol used was approved by the
ethics committee of the Institute of Biomedical Sci-
ences of the Sa˜o Paulo University.

Electrical Stimulation.

Rats were anesthetized with

sodium pentobarbital (75 mg/kg body weight) and
had their right sciatic nerve exposed through a lat-
eral section on the thigh where a platinum elec-
trode was connected. The rats were then fastened
on an acrylic platform with a metallic bar crossing
the right knee to fix the limb. Another metallic
bar was fixed at the Achilles tendon, connecting
the hindfoot to a force transducer (Myograph F-
2000; Narco Bio-Systems, Austin, Texas) that indi-
cated the generated tension by using a polygraph
(Narco Bio-Systems). The contralateral limb was
fastened to the platform by adhesive tape. Rats
were kept under external warming to maintain
core temperature during the entire procedure.

The animals were subjected to an intense elec-

trical

stimulation

protocol

as

described

else-

where.

8,9

Briefly, the stimulus consisted of 200-ms

trains delivered each second for 1 hour. The pulses
in the train were delivered at a frequency of 100
H

Z

with a duration of 0.1 ms. The voltage was 24



3 V. In order to reach maximum force output, the
muscle rest length and the stimulation voltage
were adjusted at the beginning of each experi-
ment. Soleus muscles from ES and CL limbs were
removed 1 hour after electrical stimulation. Con-
trol rats were subjected to the same conditions as
the experimental group, including surgery and fix-
ation to the platform, but with no electrical stimu-
lation. The tissues were extracted, immediately fro-
zen in liquid nitrogen, and kept at

70



C for the

assays. Rats were killed by cervical dislocation.

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

839

Analysis of Gene Expression by Macroarray.

Total

RNA Extraction. Total RNA was obtained from 100
mg of soleus muscle using 1 ml of Trizol reagent.
After 5-minute incubation at room temperature,
200

ll of chloroform was added to the tubes and

centrifuged at 12,000g. The aqueous phase was
transferred to another tube. RNA was pelleted by
centrifugation (12,000g) with cold ethanol, and
then dried in air. RNA pellets were eluted in
RNase-free water and treated with DNase I. The
RNA preparation was then stored at

70



C until

the time of the experiment. RNA was quantified by
measuring absorbance at 260 nm. The purity of
the RNA preparation was assessed by the 260/280-
nm ratio on a 1% agarose gel stained with ethi-
dium bromide at 5 mg/ml. These samples were
used for macroarray and real-time reverse tran-
scription–polymerase

chain

reaction

(RT-PCR)

analysis.

Synthesis of cDNA Probes. A pool of total RNA

from three soleus muscles of each group (control,
ES, and CL) was prepared using 10

lg of RNA

from each muscle, as described earlier. The array
experiment was performed three times with three
different pools of RNA. The RNA was pooled to
reduce the individual variability.

10

cDNA probes were synthesized using a pure

total RNA labeling system according to the manu-
facturer’s recommendations (Atlas Kit; Clontech
Laboratories, Mountain View, California). Briefly,
15

lg of total RNA pool from soleus muscles of

each group and 2

ll of primer mix (a mixture of

primers relative to the genes spotted in the macro-
array membrane) were heated at 70



C for 5 minutes

in a thermal cycler (Techne-Genius, Oxford, UK).
The temperature was decreased to 50



C, and

13.5

ll of the mix of the following reagents were

added: 4

ll of 5 reaction buffer; 0.5 ll of

100 mM dithiothreitol (DTT); 2

ll of 10 dNTP

mix (dCTP, dGTP, dTTP, dATP); 5

ll of (a-

33

P)ATP

(at 10

lCi/ll); and 2 ll of reverse transcriptase. The

mixture was incubated for 25 minutes at 50



C,

which was stopped by adding 2

ll of Termination

Mix. The

33

P-labeled probe was purified from unin-

corporated nucleotides by passing the reaction mix-
ture through a push column (NucleoSpin Extrac-
tion Spin Column; Clontech).

Macroarray Membrane Hybridization. The Atlas

Toxicology 1.2 Array (Clontech) was used to analyze
the effect of electrical stimulation on gene expres-
sion. The list of genes in the macroarray membranes
is available on the Clontech website (http://www.
clontech.com/support/tools.asp?product_tool_id

¼

157578&tool_id

¼157579). The membrane was pre-

hybridized for 30 minutes at 68



C in Express Hyb

containing 50

lg of freshly denaturated salmon

sperm DNA. Subsequently, the membrane was
hybridized during 18 hours at 68



C with

33

P-labeled

denaturated probe (2

 10

6

cpm/ml). The mem-

brane was then washed four times at 68



C with 1



SSC and 0.1% SDS, followed by washing in 1

 SSC,

1% SDS, and then exposed to phosphor screen for
48 hours and scanned on an imaging system (Storm
840; Molecular Dynamics, Sunnyvale, California).

Analysis of Macroarray Results.

Changes in gene

expression from IP and CL muscles were analyzed
by comparison with results of expression observed
in soleus muscle from control rats using Array-Pro
Analyzer, version 4 software (Media Cybernetics,
Silver Spring, Maryland). The results were pre-
sented as the mean of normalizations performed
using the housekeeping gene glyceraldehyde-3-
phosphate dehydrogenase (GAPDH), which is
present in the membrane. Triplicate hybridizations
using separate sets of nylon membranes were per-
formed for all conditions. Only signals that dif-
fered from control by at least 1.8-fold in the three
independent experiments were considered to be
significantly regulated. A similar procedure was
used in our previous studies.

11–13

Real-Time

RT-PCR

Analysis.

Real-time

RT-PCR,

using specific primers, was performed to confirm
the differential expression of the mRNAs detected
in the macroarray analysis. Total RNA was extracted
from soleus muscles as described previously. Total
RNA (2

lg) was reverse transcribed to cDNA using

reverse transcriptase Revertaid M-MuLV.

Expression of SOD2 (MnSOD), catalase, heat

shock protein HSP70, HSP90, and MAP kinase ki-
nase 1 (MEK1) was determined by real-time PCR
(Rotor Gene-3000; Corbett Research, Mortlake,
Australia) using the Platinum SYBR Green qPCR
SuperMix-UDG (Invitrogen). The sequences of the
primers were designed using information from the
GenBank public database of the National Center
for Biotechnology Information. These sequences
and the thermal cycler protocol are described in
Table 1.

The relative quantitation value of each target

gene was analyzed using a comparative cycle
threshold (CT) method.

14,15

The following for-

mula was used to calculate the relative amount of
transcript in the sample and normalized to endog-
enous reference (GAPDH): 2

DDCT

, where

DCT is

the difference in CT between the gene of interest

840

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

and the housekeeping, and

DDCT for the sample

¼ mean DCT of the sample  mean DCT of the
control sample (used as calibrator).

GAPDH was used as the housekeeping gene

based on information described by others

15

and

reported in our previous studies.

8,10

The decision

to use GAPDH was also based on the use of the
GeNorm program. This program determines the
most stable reference genes from a set of tested
genes in a given cDNA sample panel. It allows cal-
culation of a gene expression normalization factor
for each tissue sample based on the geometric
mean of a user-defined number of reference
genes. GeNorm allows calculation of gene expres-
sion stability measured (M) for a reference gene as
the average pairwise variation (V) for that gene
with all other tested reference genes. Stepwise
exclusion of the gene with the highest M value
allows ranking of the tested genes according to
their expression stability.

Statistical Analysis.

The differences between con-

trol and CL or ES muscles were assessed by non-
paired Student’s t-test. Comparison between CL
and ES muscle was performed by paired Student’s
t-test. Significance was set at P

< 0.05. Results are

presented as mean

 SEM. Analyses were per-

formed using GraphPad Prism, version 4.00 for
Windows (GraphPad Software, San Diego, Califor-
nia, www.graphpad.com).

RESULTS

Increased expression of 92 genes (16% of the
genes present in the membrane) was observed in
the ES soleus muscle as compared with non-stimu-
lated controls (Table 2). Expression of 66 genes
was upregulated in both ES and CL muscles,
whereas expression of 26 genes was upregulated in
the ES muscle only (Table 2). The intensity of

increase in gene expression of the CL soleus mus-
cle was clearly lower than that for ES (Table 2).

The most altered genes were those related to

stress response (13 genes) and metabolism (19
genes). Electrical stimulation also increased expres-
sion of genes related to transcription factors (8
genes), cell cycle (4 genes), translation and post-
translational modification (5 genes), protein modi-
fication enzymes (2 genes), ribosomal proteins (5
genes), growth factors and chemokines (2 genes),
intracellular transducers/effectors/modulators (5
genes), amino acid metabolism (1 gene), metallo-
proteinases (2 genes), protein turnover (3 genes),
calcium-binding proteins (2 genes), DNA synthe-
sis/recombination/repair (4 genes), and protease
inhibitors (3 genes). Expression of the HSP90
gene showed the most pronounced increases, by
73.8- and 13.4-fold in the ES and CL muscles,
respectively.

Expression of a number of genes related to

stress response, metabolism, and protein synthesis
was increased by at least tenfold: Hsp70/Hsp90-
organizing protein; T-complex protein 1; HSP60;
suppression of tumorigenicity 13; HSP90, thiore-
doxin 2; superoxide dismutase 1 and 2; cyto-
chrome P450; hydroxysteroid 11

b dehydrogenase

2; enoyl coenzyme A hydratase; acetyl-coenzyme A
dehydrogenase; peroxiredoxin 1; protein disulfide
isomerase–related protein; nucleophosmin 1; pro-
tein disulfide isomerase; defender against cell
death 1; and ribosomal proteins S3, S19, L6, and
L13A (Table 2).

Six genes that had their expression increased

by electrical stimulation as indicated by macroarray
were chosen for further analysis by real-time RT-
PCR. A marked increase of mRNA levels of SOD2
(7.8- and 5.9-fold), catalase (8.5- and 6.2-fold),
HSP70 (6.1- and 3.8-fold), HSP60 (3.2- and 2.2-
fold), and MEK1 (6.8- and 4.8-fold) was observed
in the ES and CL soleus muscles, respectively, as

Table 1. Standardized conditions for real-time RT-PCR analysis.

GenBank
accession no.

Gene

Sense primer

Antisense primer

Annealing

temperature (



C)

M17701

GAPDH

5

0

GGTGCTGAGTATGTCGTGGAG3

0

5

0

ATATTTCTCGTGGTTCACACCC3

0

56

X54793

HSP60

5

0

ATGGGTGCCTATGCTCCTGAGC3

0

5

0

ATGGGTGCCTATGCTCCTGAGC3

0

58

X54793

HSP70

5

0

GAGATCATCGCCAACGACCAG3

0

5

0

CTCGCCCTTGTAGTTCACCTGC3

0

60

S45392

HSP90

5

0

ACCAGGTAGGCAGAGTAGAAGC3

0

5

0

GACTACGGGACCTGTTCTAAGC3

0

57

X56600

SOD2

5

0

GACCTGCCTTACGACTATG3

0

5

0

TACTTCTCCTCGGTGACG3

0

55

M11670

Catalase

5

0

ATTGCCGTCCGATTCTCC3

0

5

0

CCAGTTACCATCTTCAGTGTAG3

0

55

M64300

MEK1

5

0

AGTGAGGAGACGGCATTCACCC3

0

5

0

CTCGTTCGCTTTGGTATGCCC3

0

58

Sequences of the primers and the temperatures and number of cycles used are shown for each gene studied. RT-PCR, reverse transcription–polymerase
chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HSP, heat shock protein; MEK1, mitogen-activated protein kinase kinase 1;
SDHA, succinate dehydrogenase complex.

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

841

Table 2. Modifications of gene expression in stimulated and contralateral soleus muscle isolated 1 hour after electrical stimulation.

GenBank
accession no.

Gene name

ES/Ct

CL/Ct

Transcription factors and related proteins

X63369

Zinc finger protein 36

3.9

2.2

X63594

Nuclear factor of kappa light-chain gene enhancer in B-cells inhibitor, alpha

3.4

D10862

Inhibitor of DNA binding 1, helix–loop–helix protein (splice variation)

4.1

2.3

Z12020

Mdm2, transformed 3T3 cell double minute 2

2.8

AF090306

Retinoblastoma binding protein 7

4.7

2.5

Z17223

Mesenchyme homeo box 2

5.1

2.1

U17013

POU domain class 2, transcription factor 1

5.4

2.2

X17163

V-jun sarcoma virus 17 oncogene homolog (avian)

5.3

1.9

Cell cycle

M18416

Early growth response 1

3.7

2.2

D14013

Cyclin C

2.9

X70871

Cyclin G1

5.7

2.0

D31838

Wee1 tyrosine kinase

2.9

Intercellular adhesion

S80439

OB-cadherin 1

3.8

2.0

Stress response

M86389

Heat shock 27-kDa protein 1

4.9

X15705

Testis-specific heat shock protein–related gene hst70

3.3

Y00054

Heat shock protein 8

4.7

2.8

X15187

Tumor rejection antigen (gp96) 1

5.6

3.0

M69246

Serine (or cysteine) proteinase inhibitor, clade H, member 1

4.9

2.4

Y15068

Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein)

20

11.0

U83843

T-complex protein 1 eta subunit (TCP1-eta); CCT-eta (CCTH; CCT7); HIV-1 NEF-interacting protein

(rat homolog of human)

20.2

11.0

D90345

T-complex 1

33.7

12.3

X54793

Heat shock protein 60 (liver)

16.7

5.6

Z27118

Heat shock 70-kDa protein 1

A

5.9

3.1

X82021

Suppression of tumorigenicity 13 (colon carcinoma) HSP70-interacting protein

11.0

5.6

S45392

Heat shock 90-kDa protein beta (HSP90-beta); HSP84; HSPCB

73.8

13.4

S78556

Mitochondrial stress-70 protein precursor (MTHSP70); 75-kDa glucose-regulated protein (GRP75);

peptide-binding protein 74 (PBP74); mortalin; HSPA9

6.5

2.0

Voltage-dependent Ionic Channels

M21730

Annexin 5

2.7

Metabolism

M22413

Carbonic anhydrase 3

8.5

M31788

Phosphoglycerate kinase 1

5.7

U73525

Thioredoxin 2

19.5

6.4

Y00404

Superoxide dismutase 1

23.9

5.5

M11670

Catalase

14.0

8.0

X56600

Superoxide dismutase 2

31.8

14.3

D12770

Solute carrier family 25 (mitochondrial adenine nucleotide translocator) member 4

7.4

U09540

Cytochrome P450, subfamily 1B, polypeptide 1

4.1

M21208

Cytochrome P450, subfamily 17

13.6

6.9

L03294

Lipoprotein lipase

7.7

2.9

J04171

Glutamate oxaloacetate transaminase 1

6.7

M18467

Glutamate oxaloacetate transaminase 2

6.6

3.0

J05405

Heme oxygenase 2

6.2

3.5

D30647

Acyl-coenzyme A dehydrogenase, very long chain

4.5

U22424

Hydroxysteroid 11beta dehydrogenase 2

17.1

7.7

M23995

Aldehyde dehydrogenase family 1, subfamily A4

8.6

4.7

X15958

Enoyl coenzyme A hydratase, short chain 1

24.7

9.4

J05029

Acetyl-coenzyme A dehydrogenase, long chain

15.7

7.0

D30035

Peroxiredoxin 1

20.6

6.1

X12367

Glutathione peroxidase 1

6.2

Translation/post-translational modification/protein folding

M86870

Protein disulfide isomerase–related protein (calcium-binding protein, intestinal-related)

12.1

6.9

L24804

Progesterone receptor–associated protein

4.2

M75715

Eukaryotic translation termination factor 1

2.0

J03969

Nucleophosmin 1

19.0

6.3

842

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

Table 2. Continued.

GenBank
accession no.

Gene name

ES/Ct

CL/Ct

X02918

Protein disulfide isomerase (prolyl 4-hydroxylase, beta polypeptide)

22.8

9.5

Protein modification enzymes

U94340

ADP-ribosyltransferase 1

5.5

4.1

Y13336

Defender against cell death 1

37.3

18.1

Ribosomal proteins

X51536

Ribosomal protein S3

15.8

9.4

X51707

Ribosomal protein S19

16.3

3.3

X58465

Ribosomal protein S5

2.6

X87107

Ribosomal protein L6

24.0

8.3

X68282

Ribosomal protein L13A

47.6

7.6

RNA processing, turnover, and transport

U22893

Cold shock domain protein A

5.4

D17711

Heterogenous nuclear ribonuclopotein K

3.9

1.9

D84418

High-mobility group box 2

4.1

2.3

Receptors

U59809

Insulin-like growth factor 2 receptor

2.2

M25804

Nuclear receptor subfamily 1, group D, member 1

4.5

2.7

L06482

Retinoid X receptor alpha

3.2

U84402

Smoothened

6.1

3.2

Growth factors, cytokines, and chemokines

M32167

Vascular endothelial growth factor

6.8

2.9

U06436

Chemokine (C—C motif) ligand 5

4.0

Intracellular transducers/effectors/modulators

M64301

Mitogen-activated protein kinase 6

4.8

2.7

D14592

Mitogen-activated protein kinase kinase 2

5.0

1.9

M64300

Mitogen-activated protein kinase kinase 1

5.8

2.8

L27112

Stress-activated protein kinase alpha II

3.4

1.9

L27129

Mitogen-activated protein kinase 8

5.5

3.0

Amino acids metabolism

D17615

Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

3.7

Calcium-binding proteins

L18889

Calnexin

4.5

2.4

X53363

Calreticulina

7.1

2.3

Protein turnover

X62671

Finkel–Biskis–Reilly murine sarcoma virus ubiquitously expressed

5.9

2.0

D63673

Peroxisomal biogenesis factor 6

4.1

2.0

AF095740

Neural precursor cell expressed, developmentally downregulated gene 8

5.2

1.9

Metalloproteinases

U46034

Matrix metalloproteinase 11 (stromelysin 3)

3.9

1.8

D87336

Bleomycin hydrolase (BLM hydrolase, BLMH, BMH)

4.9

2.2

Cysteine proteases

D63378

Glucose-regulated protein, 58 kDa

5.8

2.5

Protease inhibitors

L31884

Tissue inhibitor of metalloproteinase 2

5.6

2.2

J02635

Alpha-2-macroglobulin

8.4

4.1

D00753

Serine protease inhibitor

3.0

Intermediate filament proteins

X62952

Vimentin

5.7

DNA synthesis, recombination, and repair

Y00047

Proliferating cell nuclear antigen

4.3

2.3

J03250

DNA topoisomerase I

3.5

1.9

D00144495

Apurinic/apyrimidinic endonuclease 1

3.5

AJ006070

Recombination activation protein 1

7.2

3.5

Non-classified proteins

L28818

Involucrin gene

6.0

M17698

Thymosin, beta 10

6.8

2.3

D50093

Prion protein

9.3

3.9

Results are shown as electrically stimulated (ES) and control (Ct) or contralateral (CL) and control ratios. Total RNA was isolated, retrotranscribed,

33

P-labeled, and hybridized to the cDNA array membrane presenting 1176 transcripts of known genes. The signals were then analyzed with Pro-Analysis

Array-Pro Analyzer software, version 4 (Media Cybernetics, Silver Spring, Maryland) and expressed as IP and Ct or CL and Ct ratios. Only signals that
differed from the cells isolated in the pre-diet period by at least twofold were considered significant. See Methods for details of the calculation.
Bold entries indicate expression of genes that were increased by at least tenfold.

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

843

compared with non-stimulated (control) muscles
(Fig. 1). Although the magnitude was not the
same, the direction of changes induced by electri-
cal stimulation was consistent in both macroarray
and real-time RT-PCR analysis. Expression of
HSP70 (Figure 2), MEK1 (Figure 6), catalase (Fig-
ure 4), and SOD2 (Figure 5), was differentially
modulated in ES and CL soleus muscle.

DISCUSSION

The major finding observed in this study was an
overall induction of gene expression in the ES sol-
eus muscle when compared with non-stimulated
controls. A similar effect was observed in the CL

muscle, but of a lower magnitude. The macroarray
analysis revealed an increased expression of 92
genes after electrical stimulation, from which 66
genes were upregulated in both ES and CL muscles.
So, the CL leg muscles also respond to muscle con-
tractions. This effect has also been described by
other investigators who used the terms contralateral
effect or cross-education.

16

Improvement of contra-

lateral muscle force after a training program has
been associated with neural adaptations at central
(cortical) and peripheral levels.

17,18

However, the

full mechanism involved in the cross-education phe-
nomenon remains poorly understood.

2,16,18

FIGURE 2. mRNA levels of HSP70 in control (white bars), elec-
trically stimulated (ES) (light gray bars), and contralateral (CL)
(dark gray bars) soleus muscle at 1 hour after electrical stimula-
tion. The analysis was performed by real-time RT-PCR. *

P <

0.001 compared with values from control;

^

P < 0.05 compared

with values from electrically stimulated muscle.

FIGURE 1. mRNA levels of heat shock protein 60 (HSP60) in
control (white bars), electrically stimulated (ES) (light gray
bars), and contralateral (CL) (dark gray bars) soleus muscle at
1 hour after electrical stimulation. The analysis was performed
by real-time RT-PCR. *

P < 0.001 compared with values from

control.

FIGURE 4. mRNA levels of Mn-superoxide dismutase (SOD2)
in control (white bars), electrically stimulated (ES) (light gray
bars), and contralateral (CL) (dark gray bars) soleus muscle at
1 hour after electrical stimulation. The analysis was performed
by real-time RT-PCR. *

P < 0.001 compared with values from

control;

^

P < 0.05 compared with values from electrically

stimulated muscle.

FIGURE 3. mRNA levels of HSP90 in control (white bars), elec-
trically stimulated (ES) (light gray bars), and contralateral (CL)
(dark gray bars) soleus muscle at 1 hour after electrical stimula-
tion. The analysis was performed by real-time RT-PCR. *

P <

0.001 compared with values from control.

844

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

Expression of several genes related to stress

response, protein synthesis, and metabolism was
increased by at least tenfold due to muscle contrac-
tion (Table 2). This fact indicates that a single ses-
sion of electrical stimulation is enough to increase
the expression of genes involved with hypertrophy
and metabolic adaptations. One report showed a
marked increase in maximal activity (63%) and
expression (80%) of citrate synthase at 1 hour after
muscle contraction induced by electrical stimula-
tion in rat soleus muscles.

8,16

Increased expression

of SOD, catalase, and glutathione peroxidase was
also found. These observations indicate that muscle
contraction, even for a very short time, increases ac-
tivity and expression of important proteins involved
in energy production and resistance to fatigue.

8,16

To validate the results of the macroarray analy-

sis, six genes were selected for confirmation of
changes using RT-PCR. Expression of HSP60,
HSP70, HSP90, SOD2, catalase, and MEK1 was
increased by electrical stimulation in the ES and
CL muscles. These proteins have constitutive roles
in skeletal muscle and play an important part in
maintaining muscle function. Most of these proc-
esses (e.g., protein synthesis, metabolism, and
stress response) are highly interconnected and
form a complex signaling network during muscle
recovery from injury.

5

ES increased expression of

several heat shock proteins, in particular HSP27,
HSP60, HSP70, and HSP90, as observed in the
macroarray results. This latter effect has been asso-
ciated with various components of the cytoskeleton
and steroid hormone receptors.

19

HSP70 is known

to mediate repair and degradation of altered or

denaturated proteins.

5

Increased HSP expression

due to a single session of exercise has been
described.

14

Venojarvi et al. tested the effects of 4-

week immobilization and subsequent remobiliza-
tion on HSP expression and oxidative stress in the
lateral gastrocnemius and plantaris muscles of
rats.

20

They found that expression of HSPs was up-

regulated during the recovery from immobiliza-
tion, particularly in the lateral gastrocnemius mus-
cle. Following immobilization, both intensive and
spontaneous exercise upregulated HSP expression
in the lateral gastrocnemius and partly in the plan-
taris muscle.

20

Expression of the genes of oxidative stress was

also raised by muscle contraction. SOD and CAT
play an important role in the intracellular redox
balance. Recently, we have shown increased expres-
sion of SOD1, SOD2, and catalase in the ES soleus
muscle, suggesting that these antioxidant enzymes
are important signaling components for maintain-
ing muscle function.

8

ES also increased expression

of ribosomal proteins S3, S19, L6, and L13A by at
least tenfold. Ribosomal proteins have the complex
task of coordinating protein biosynthesis, yet regu-
lation of their expression remains unknown. Skele-
tal muscle hypertrophy occurs in part due to an
increase in protein mass per fiber. This accumula-
tion of protein results from a net increase in pro-
tein synthesis in relation to protein breakdown.
Increased rates of protein synthesis (translation)
have been reported in several models of resistance
exercise.

21,22

FIGURE 6. mRNA levels of MAP kinase kinase 1 (MEK1) in
control (white bars), electrically stimulated (ES) (light gray
bars), and contralateral (CL) (dark gray bars) soleus muscle at
1 hour after electrical stimulation. The analysis was performed
by real-time RT-PCR. *

P < 0.001 compared with values from

control;

^

P < 0.05 compared with values from electrically

stimulated muscle.

FIGURE 5. mRNA levels of catalase in control (white bars),
electrically stimulated (ES) (light gray bars), and contralateral
(CL) (dark gray bars) soleus muscle at 1 hour after electrical
stimulation. The analysis was performed by real-time RT-PCR.
*

P < 0.001 compared with values from control.

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009

845

MEK1 has been described as a potent activator

of mitogen-activated protein kinases (MAPKs),
including extracellular signal–related kinase (ERK),
Jun kinase (JNK), and p38 MAPK. These proteins
exert important signaling effects on metabolism
and adaptive responses in skeletal muscle.

23,24

MAPK8 (or JNK) pathway activation by muscle con-
traction per se has been associated with mitochon-
drial biogenesis.

25

In this study, an increase of 5.8-,

4.8-, and 5.5-fold in expression of MEK1, MAPK6,
and MAPK8, respectively, was found.

A marked increase in expression of anti-apopto-

tic genes, such as defender against cell death 1,
nucleophosmine, and, as mentioned earlier, ribo-
somal proteins S3, S19, L6, and L13A, was
observed in the ES and CL muscles. There has
been no previous study on expression of these
genes after a single exercise session.

In conclusion, evidence has been presented

herein that high-intensity muscle contraction pro-
motes increased expression of genes (mainly those
related to protein synthesis and metabolism) in
both ES and CL soleus muscles. These observa-
tions strongly suggest that exercise training in the
CL leg of injured subjects may avoid the expected
decrease in muscle functionality in both the
injured and non-injured leg.

This study was supported by the Conselho Nacional de Desen-
volvimento Cientı´fico e Tecnolo´gico (CNPq), Fundac¸a˜o de
Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP), and
Coordenac¸a˜o de Aperfeic¸oamento de Pessoal de Nı´vel Supe-
rior (CAPES). The authors thank E. P. Portiolli, T. C. Alba, J.
R. Mendonc¸a, and G. de Souza for their ongoing technical
assistance.

REFERENCES

1. Coffey VG, Hawley JA. The molecular bases of training ad-

aptation. Sports Med 2007;37:737–763.

2. Widegren U, Ryder JW, Zierath JR. Mitogen-activated pro-

tein kinase signal transduction in skeletal muscle: effects of
exercise and muscle contraction. Acta Physiol Scand 2001;
24:227–238.

3. Kannus P, Alosa D, Cook L, Johnson RJ, Renstro

¨m P, Pope M,

et al. Effect of one-legged exercise on the strength, power
and endurance of the contralateral leg. A randomized, con-
trolled study using isometric and concentric isokinetic train-
ing. Eur J Appl Physiol Occup Physiol 1992;64:117–126.

4. Jørgensen SB, Jensen TE, Richter EA. Role of AMPK in skel-

etal muscle gene adaptation in relation to exercise. Appl
Physiol Nutr Metab 2007;32:904–911.

5. Kiang JG, Tsokos GC. Heat shock protein 70 kDa: molecular

biology, biochemistry, and physiology. Pharmacol Ther
1998;80:183–201.

6. Seip RL, Mair K, Cole TG, Semenkovich CF. Induction of

human skeletal muscle lipoprotein lipase gene expression

by short-term exercise is transient. Am J Physiol 1997;272:
E255–E261.

7. Brown AB, McCartney N, Sale DG. Positive adaptations to

weight-lifting training in the elderly. J Appl Physiol 1990;69:
1725–33.

8. Pimenta AS, Lambertucci RH, Gorja˜o R, Silveira LR, Curi R.

Effect of a single session of electrical stimulation on activity
and expression of citrate synthase and antioxidant enzymes
in rat soleus muscle. Eur J Appl Physiol 2007;102:119–126.

9. Wojtaszewski JF, Hansen BF, Ursø B, Richter EA. Wortman-

nin inhibits both insulin- and contraction-stimulated glucose
uptake and transport in rat skeletal muscle. J Appl Physiol
1996;81:1501–1509.

10. Lambertucci RH, Levada-Pires AC, Rossoni LV, Curi R,

Pithon-Curi TC. Effects of aerobic exercise training on antioxi-
dant enzyme activities and mRNA levels in soleus muscle from
young and aged rats. Mech Ageing Dev 2007;128:267–275.

11. Fernanda Cury-Boaventura M, Cristine Kanunfre C, Gorja˜o

R, Martins de Lima T, Curi R. Mechanisms involved in
Jurkat cell death induced by oleic and linoleic acids. Clin
Nutr 2006;25:1004–1014.

12. Gorja˜o R, Verlengia R, Lima TM, Soriano FG, Boaventura

MF, Kanunfre CC, et al. Effect of docosahexaenoic acid-rich
fish oil supplementation on human leukocyte function. Clin
Nutr 2006;25:923–938.

13. Verlengia R, Gorja˜o R, Kanunfre CC, Bordin S, Martins De

Lima T, et al. Comparative effects of eicosapentaenoic acid
and docosahexaenoic acid on proliferation, cytokine pro-
duction, and pleiotropic gene expression in Jurkat cells.
J Nutr Biochem 2004;15:657–665.

14. Livak KJ, Schmittgen TD. Analysis of relative gene expres-

sion data using real-time quantitative PCR and the 2(

Delta

Delta C(T)) method. Methods 2001;25:402–408.

15. Pfaffl MW. A new mathematical model for relative quantifi-

cation in real-time RT-PCR. Nucleic Acids Res 2001;29:e45.

16. Hortoba´gyi T, Scott K, Lambert J, Hamilton G, Tracy J. Cross-

education of muscle strength is greater with stimulated than
voluntary contractions. Motor Control 1999;3:205–219.

17. Carroll TJ, Herbert RD, Munn J, Lee M, Gandevia SC. Contra-

lateral effects of unilateral strength training: evidence and
possible mechanisms. J Appl Physiol 2006;101:1514–1522.

18. Zhou S. Chronic neural adaptations to unilateral exercise:

mechanism of cross-education. Exerc Sport Sci Rev 2000;
272:177–184.

19. Young RA. Stress proteins and immunology. Annu Rev

Immunol 1990;20:401–420.

20. Venojarvi M, Aunola S, Puhke R, Marniemi J, Hamalainen

H, Halonen JP, et al. Exercise training with dietary counsel-
ling increases mitochondrial chaperone expression in mid-
dle-aged subjects with impaired glucose tolerance. BMC
Endocrine Disord 2008;8:3.

21. Nader GA, Hornberger TA, Esser KA. Translational control:

implications for skeletal muscle hypertrophy. Clin Orthop
Rel Res 2002;403(suppl):S178–S187.

22. Ploutz LL, Tesch PA, Biro RL, Dudley GA. Effect of resist-

ance training on muscle use during exercise. J Appl Physiol
1994;76:1675–1681.

23. Leng Y, Steiler TL, Zierath JR. Effects of insulin, contrac-

tion, and phorbol esters on mitogen-activated protein ki-
nase signaling in skeletal muscle from lean and ob/ob
mice. Diabetes 2004;53:1436–1444.

24. Silveira L, Hirabara SM, Alberici LC, Lambertucci RH, Peres

CM, Takahashi HK, et al. Effect of lipid infusion on metab-
olism and force of rat skeletal muscles during intense con-
tractions. Cell Physiol Biochem 2007;20:213–226.

25. Wu JJ, Roth RJ, Anderson EJ, Hong EG, Lee MK, Choi CS,

et

al.

Mice lacking MAP kinase phosphatase-1

have

enhanced MAP kinase activity and resistance to diet-induced
obesity. Cell Metab 2006;4:61–73.

846

Electrical Stimulation and Gene Expression in Soleus

MUSCLE & NERVE

November 2009